각종 샘플(세포, 조직, 환경샘플 등)로부터 고품질
DNA나 RNA를 가장 쉽고 빠르게 뽑을 수 있습니다.
이 외에도, 각종 Epigenetics 관련 제품들
(DNA Methylation kit 등)과 Microbiomics
(샘플 채집부터 분석까지의 전 단계의 제품)
연관 제품들이 준비되어 있습니다.
제품정보
Kyongshin PRODUCT

제품소개
| Sample Input | Purified microbial DNA ≤100 ng, free of PCR inhibitors. |
|---|---|
| ITS Primer Sequences (adapters not shown) | ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). |
| Index Primers | Dual index (barcodes) to uniquely label samples. |
| Barcode Sequences | 10 bp barcodes, Available for download here (USA Only), or by visiting the Documentation section of the D6425 Product Page at www.zymoresearch.com. |
| Amplicon Size | The final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp. |
| Sequencing Platform | Illumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F. |
| Required Equipment | Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates. |
주문정보
| CAT.No | 품명 | 규격 | 비고 |
|---|---|---|---|
| D6425-PS1 | Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 1 | 96 rxns | |
| D6425-PS2 | Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 2 | 96 rxns | |
| D6425-PS3 | Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 3 | 96 rxns | |
| D6425-PS4 | Quick-ITS Plus NGS Library Prep Kit (UDI) with Primer Set 4 | 96 rxns |